hMTMR1 (PCR from Human liver cDNA):


- PCR hMTMR1 sequence including BamH1 and Xho1 sites from Human Liver cDNA.

Primers:
Forward: 5’- t aGG ATC CCC ATG GAC AGG CCa GCa GCa G -3’

We’ve changed the last bases of 3 codons to diminish GC content and
Tm

length: 29
Tm: 67ºC
%GC: 62

Reverse: 5’- gcCTCGAG tcagaccgaggtgtggacgga -3’
length: 29
Tm: 69ºC
%GC: 66

Trying Nested strategy:
NEW Nested primers: Forward: 5’-CCAGGTGACAGCTAATGGCGG-3’ (21, 58, 62%) (4.9 mg/ml)
Reverse: 5’- GGCTTCTCTGGTTTGTCGAAGGC -3’ (23, 59, 57%) (2.5 mg/ml)

 

- After PCR, run product and recove1.9 Kb band.

 

!!band was not seen!!